Geri Dön

Molecular cloning, sequencing and transcriptional analyses of the genes coding for 5-aminolevulinic acid synthase isoenzymes in Rhodobacter sphaeroides O.U.001

Rhodobacter sphaeroıdes O.U.001'de bulunan 5-aminolevulinik asit sentaz izoenzimlerini kodlayan genlerin klonlanması, dizilenmesi ve transkipsiyonel analizleri

PDF İndir

  1. Tez No: 453494
  2. Yazar: MARWA HASSAN JAWAD JAWAD
  3. Danışmanlar: PROF. DR. GIYASETTİN KAŞIK
  4. Tez Türü: Yüksek Lisans
  5. Konular: Biyoloji, Biyoteknoloji, Biology, Biotechnology
  6. Anahtar Kelimeler: Belirtilmemiş.
  7. Yıl: 2017
  8. Dil: İngilizce
  9. Üniversite: Selçuk Üniversitesi
  10. Enstitü: Fen Bilimleri Enstitüsü
  11. Ana Bilim Dalı: Biyoloji Ana Bilim Dalı
  12. Bilim Dalı: Moleküler Biyoloji Bilim Dalı
  13. Sayfa Sayısı: 57

Özet

Fotosentetik bakteri grubundan olan mor kükürtsüz (Purple non-sulfur, PNS) bakterilerde C-4 yoluyla, ALA' nın glisin ve süksinil-CoA'dan sentezini sağlayan anahtar enzim, ALA sentaz enzimidir. Canlılarda 5-ALA biyosentezi iki farklı yolla gerçekleşmektedir: (1) Süksinil-CoA ve glisin kullanılarak (Shemin pathway, C-4 pathway) ve (2) glutamat kullanılarak (C-5 pathway). R. sphaeroides ALA'yı C-4 yoluyla sentezlemektedir. C-4 yolunun ana ve tek enzimi ALA sentaz enzimidir. R. Sphaeroides'te ALA sentaz enzminin iki izoenzimi ve bu izoenzimleri kodlayan iki gen (hemA ve hemT) mevcuttur. Bu genlerin (hemA ve hemT) varlığı dikkate alındığında, R. sphaeroides suşları arasında önemli bir farklılık olduğu tespit edilmiştir. Bazı suşlarda hemT geni bulunmazken bazı suşlarda her iki gene de rastlanmamıştır. Bu durum R. sphaeroides'in genomik kompleksitesi olarak belirtilmiştir. Yani R. sphaeroides'in suşları arasında bile önemli genetik farklılıklar olmaktadır. Bu doğrultuda, C-4 5-aminolevulinik asit (5-ALA) sentez yolunda bulunan tek ve ana enzim olan ALA sentaz enziminin iki farklı formunu kodlayan genlerin (hemA ve hemT) klonlanması, dizilenmesi ve transkripsiyonel analizlerinin gerçekleştirilmesi planlanmıştır. Primer3 software tarafından hemA ve hemT yükseltmek için farkli primerler tasarlandı. Primerlerin ilk seti, R. Sphaeroides 2.4.1'in hemA geni kullanılarak dizayn edilmiştir (Sol primer 5'- GCGATATAGGTGGCCTTGAT- 3' ve Sağ primer 5'- CAGCCTATCGTCCGATGC - 3') , ve hiçbir sonuç elde edilmemiştir. HemA geninin ikinci seti R. sphaeroides 17025'dan elde edilmiştir. hemA geni (Sol primer 5'-CCTTTGCATCCGCAGAAGC- 3' ve Sağ primer 5'-CCAATGAACGGGTTTCAAATTG -3') primerleri kullanılarak Polimeraz Zincir Reaksiyonu (PZR) ile büyütülmüştür. PCR R. Sphaeroides O.U. 001 gDNAve Phusion DNA polimeraz enzimi kullanılarak yapıldı. 1370 bp uzunlugunda hemA geni başarıyla çoğaltıldı. Dizi analizi NGS kullanılarak yapılmıştır ve daha sonra homoloji / patlama arama Ulusal Biyoteknoloji Bilgi Merkezi NCBI de yapıldı. R. sphaeroides O.U.001 bölgesinin hemA sekansı R. sphaeroides17025 benzer %99.6 olarak bulunmuştur. Daha sonra hemA geni, pBluescript SK (+) klonlama vektörünün EcoRV içine klonlanmıştır. Escherichia coli XL1 Mavi dönüştürmeden sonra, yeniden rekombinant klonlar mavi / beyaz tarama ile seçilmiştir ve sınırlama enzimi sindirimi ve dizi analizi ile teyit edilmiştir. Rekombinant klonlar gliserol stokları, gelecekteki kullanım için -80°C'de saklandı. İki primer setleri rağmen (İlk primerlerin seti: Sol primer 5'- CGCCGTACCTACACCCATAC - 3' ve Sağ primer 5'- ATCCGGACGACCAAGCTG - 3', Primer ikinci seti: Sol primer 5'- TCCAACAGAAGGTGATCCCC - 3' ve Sağ primer 5'- ATCAAGGCGATCTCTCCGG-3') hemT geni amplifiye etmek için tasarlanmış, hiçbir sonuç elde edilmemiştir. Primerlerin ilk seti R. Sphaeroides 2.4.1'in bir hemT geni kullanılarak dizayn edilmiştir ve ikinci seti R. Sphaeroides17029'in hemT geni kullanılarak dizayn edilmiştir. Sonuç, R. Sphaeroides O.U.001'in hemT geni değil, hemA genine sahip olduğunu göstermiştir. Projemizin, bu bağlamda, Rhodobacter Sphaeroides O.U.001'deki 5-aminolevulinate sentez genini araştıran ilk çalışma olduğu görülmüştür. Biz bu calışma ile 5-aminolevulinate synthase (hemA) geninin, hem aerobic, hem de anaerobic şartlarda ekspres edildiğini gösterdik.

Özet (Çeviri)

In purple non-sulfur bacteria Rhodobacter sphaeroides that are photosynthetic bacteria, 5-aminolevulinic acid (5-ALA) is formed by the condensation of glycine and succinyl-CoA, catalyzed by the pyridoxal-phosphate dependent enzyme ALA synthase in C4 pathway. The synthesis of 5-ALA occurs in different ways in living things: Succinyl-CoA and glycine (Shemin pathway, C-4 pathway) and using glutamate (C-5 pathway). The enzyme of the C-4 pathway is ALA synthase. There are two isoenzymes for ALA synthase and two genes (hemA and hemT) coding for these isoenzymes in R. sphaeroides. When the genes of the C-4 metabolic pathway are taken into account, there seem some variations. While there is only hemAgene in some strains, there are no genes at all in some other strains. This situation was stated as genomic complexity of R. sphaeroides. In order to solve this situation in R. sphaeroides O.U. 001, molecular cloning and sequence analysis of C4 pathway genes (hemA and hemT genes coding for the two ALA synthase isoenzymes) was performed. For this, different primer sets were designed to amplify the hemA and hemT genes by primer3 software. The first set of primers were designed using hemA genes of R. sphaeroides 2.4.1 using the primers (Left primer 5'-GCGATATAGGTGGCCTTGAT- 3' and Right primer 5'- CAGCCTATCGTCCGATGC - 3') , no product was obtained. The second set of hemA gene obtaind from R. sphaeroides 17025, hemA gene was amplified in Polymerase Chain Reaction (PCR) using the primers (Left primer 5'-CCTTTGCATCCGCAGAAGC- 3' and Right primer 5'- CCAATGAACGGGTTTCAAATTG -3'). The PCR was done using R. sphaeroides O.U. 001 gDNA as a template and PHUSION DNA polymerase enzyme. 1370 bp long hemA gene was successfully amplified. The sequence analysis was done using Next Generation Sequencing (NGS) and then homology/blast search was done at National Center for Biotechnology Information (NCBI). The hemA sequence of R. sphaeroides O.U.001 was found to be 99.6% similar to that of R. sphaeroides 17025. Then the hemA gene was cloned into the EcoRV site of pBluescript SK (+) cloning vector. After transformation into Escherichia coli XL1 Blue, the recombinant clones were selected by blue/white screening and confirmed by restriction enzyme digestion and sequence analysis. The glycerol stocks of recombinant clones were stored at -80ºC for future uses. Although two primer sets (First set of primers: Left primer 5'- CGCCGTACCTACACCCATAC - 3' and Right primer 5'- ATCCGGACGACCAAGCTG - 3', Second set of primer: Left primer 5'- TCCAACAGAAGGTGATCCCC - 3' and Right primer 5'- ATCAAGGCGATCTCTCCGG-3') were designed to amplify hemT gene, no product was obtained. The first set of primers were designed using hemT genes of R. sphaeroides 2.4.1 and the second set was designed using hemT genes of R. sphaeroides 17029. The result indicated that R. sphaeroides O.U.001 has hemA gene but not hemT gene. The hemA gene was found to be expressed in both aerobic and anaerobic conditions, but it was more pronounced in anaerobic conditions. There by, our project is the first record which focuses on the 5-aminolevulinate synthase gene in Rhodobacter Sphaeroides O.U.001. We demonstrated that 5-aminolevulinate synthase (hemA) gene presents in both conditions of aerobic and anaerobic.

Benzer Tezler

  1. Tez No

    453528

    Molecular cloning, sequencing and transcriptional analyses of c5 pathway genes of 5-aminolevulinic acid synthesis in rhodobacter sphaeroides o.u.001

    Rhodobacter sphaeroides o.u.001'de c5 5-aminolevulinik asit sentez yolunda bulunan genlerin klonlanması, dizilenmesi ve transkripsiyonel analizleri

    FARMESK IBRAHIM RIDHA RIDHA

    Yüksek Lisans

    İngilizce

    İngilizce

    2017

    BiyolojiSelçuk Üniversitesi

    Biyoloji Ana Bilim Dalı

    PROF. DR. GIYASETTİN KAŞIK

  2. Tez No

    237288

    Türkiye turunçgil alanlarındaki tristeza virüs izolatlarının kılıf protein genlerinin klonlaması, dna diziliminin belirlenmesi ve analizi

    Molecular cloning, sequencing and analysis of the coat protein genes of citrus tristeza virus isolates from different citrus growing regions of Turkey

    GÖZDE ERKIŞ

    Yüksek Lisans

    Türkçe

    Türkçe

    2009

    ZiraatSüleyman Demirel Üniversitesi

    Bitki Koruma Ana Bilim Dalı

    DOÇ. DR. BAYRAM ÇEVİK

  3. Tez No

    399469

    Zeytin (Olea europaea) EST'leri (expressed sequence tags) koleksiyonundan seçilen lipid transfer geninin moleküler analizi

    Molecular analysis of lipid transfer gene selected from olive (Olea europaea) ESTs (expressed sequence tags) collection

    DİLEK ÇAĞLAR

    Yüksek Lisans

    Türkçe

    Türkçe

    2015

    BiyolojiYıldız Teknik Üniversitesi

    Moleküler Biyoloji ve Genetik Ana Bilim Dalı

    DOÇ. DR. NEHİR ÖZDEMİR ÖZGENTÜRK

  4. Tez No

    462887

    Yüksek tuz toleransına sahip fasulye genotipinde tolerans ile ilgili transkripsiyon faktörlerinin belirlenmesi

    Determi̇nati̇on of transcri̇pti̇on factors related to tolerances i̇n bean genotype wi̇th hi̇gh salt tolerances

    GÖKHAN GÖKDEMİR

    Yüksek Lisans

    Türkçe

    Türkçe

    2017

    BiyoteknolojiOndokuz Mayıs Üniversitesi

    Tarımsal Biyoteknoloji Ana Bilim Dalı

    DOÇ. DR. MUSA KAVAS

  5. Tez No

    482390

    TTH polimeraz enziminin tıbbi moleküler tanı kitlerinde kullanım amaçlı rekombinant üretimi

    Expression of recombinant TTH polymerase enzyme for development of medical molecular diagnostic kits

    HÜMEYRA AYDIN

    Yüksek Lisans

    Türkçe

    Türkçe

    2017

    BiyomühendislikGaziosmanpaşa Üniversitesi

    Biyomühendislik Ana Bilim Dalı

    PROF. DR. İSA GÖKÇE

Geri Dön