Molecular cloning, sequencing and transcriptional analyses of the genes coding for 5-aminolevulinic acid synthase isoenzymes in Rhodobacter sphaeroides O.U.001
Rhodobacter sphaeroıdes O.U.001'de bulunan 5-aminolevulinik asit sentaz izoenzimlerini kodlayan genlerin klonlanması, dizilenmesi ve transkipsiyonel analizleri
- Tez No: 453494
- Danışmanlar: PROF. DR. GIYASETTİN KAŞIK
- Tez Türü: Yüksek Lisans
- Konular: Biyoloji, Biyoteknoloji, Biology, Biotechnology
- Anahtar Kelimeler: Belirtilmemiş.
- Yıl: 2017
- Dil: İngilizce
- Üniversite: Selçuk Üniversitesi
- Enstitü: Fen Bilimleri Enstitüsü
- Ana Bilim Dalı: Biyoloji Ana Bilim Dalı
- Bilim Dalı: Moleküler Biyoloji Bilim Dalı
- Sayfa Sayısı: Belirtilmemiş.
Özet
Fotosentetik bakteri grubundan olan mor kükürtsüz (Purple non-sulfur, PNS) bakterilerde C-4 yoluyla, ALA' nın glisin ve süksinil-CoA'dan sentezini sağlayan anahtar enzim, ALA sentaz enzimidir. Canlılarda 5-ALA biyosentezi iki farklı yolla gerçekleşmektedir: (1) Süksinil-CoA ve glisin kullanılarak (Shemin pathway, C-4 pathway) ve (2) glutamat kullanılarak (C-5 pathway). R. sphaeroides ALA'yı C-4 yoluyla sentezlemektedir. C-4 yolunun ana ve tek enzimi ALA sentaz enzimidir. R. Sphaeroides'te ALA sentaz enzminin iki izoenzimi ve bu izoenzimleri kodlayan iki gen (hemA ve hemT) mevcuttur. Bu genlerin (hemA ve hemT) varlığı dikkate alındığında, R. sphaeroides suşları arasında önemli bir farklılık olduğu tespit edilmiştir. Bazı suşlarda hemT geni bulunmazken bazı suşlarda her iki gene de rastlanmamıştır. Bu durum R. sphaeroides'in genomik kompleksitesi olarak belirtilmiştir. Yani R. sphaeroides'in suşları arasında bile önemli genetik farklılıklar olmaktadır. Bu doğrultuda, C-4 5-aminolevulinik asit (5-ALA) sentez yolunda bulunan tek ve ana enzim olan ALA sentaz enziminin iki farklı formunu kodlayan genlerin (hemA ve hemT) klonlanması, dizilenmesi ve transkripsiyonel analizlerinin gerçekleştirilmesi planlanmıştır. Primer3 software tarafından hemA ve hemT yükseltmek için farkli primerler tasarlandı. Primerlerin ilk seti, R. Sphaeroides 2.4.1'in hemA geni kullanılarak dizayn edilmiştir (Sol primer 5'- GCGATATAGGTGGCCTTGAT- 3' ve Sağ primer 5'- CAGCCTATCGTCCGATGC - 3') , ve hiçbir sonuç elde edilmemiştir. HemA geninin ikinci seti R. sphaeroides 17025'dan elde edilmiştir. hemA geni (Sol primer 5'-CCTTTGCATCCGCAGAAGC- 3' ve Sağ primer 5'-CCAATGAACGGGTTTCAAATTG -3') primerleri kullanılarak Polimeraz Zincir Reaksiyonu (PZR) ile büyütülmüştür. PCR R. Sphaeroides O.U. 001 gDNAve Phusion DNA polimeraz enzimi kullanılarak yapıldı. 1370 bp uzunlugunda hemA geni başarıyla çoğaltıldı. Dizi analizi NGS kullanılarak yapılmıştır ve daha sonra homoloji / patlama arama Ulusal Biyoteknoloji Bilgi Merkezi NCBI de yapıldı. R. sphaeroides O.U.001 bölgesinin hemA sekansı R. sphaeroides17025 benzer %99.6 olarak bulunmuştur. Daha sonra hemA geni, pBluescript SK (+) klonlama vektörünün EcoRV içine klonlanmıştır. Escherichia coli XL1 Mavi dönüştürmeden sonra, yeniden rekombinant klonlar mavi / beyaz tarama ile seçilmiştir ve sınırlama enzimi sindirimi ve dizi analizi ile teyit edilmiştir. Rekombinant klonlar gliserol stokları, gelecekteki kullanım için -80°C'de saklandı. İki primer setleri rağmen (İlk primerlerin seti: Sol primer 5'- CGCCGTACCTACACCCATAC - 3' ve Sağ primer 5'- ATCCGGACGACCAAGCTG - 3', Primer ikinci seti: Sol primer 5'- TCCAACAGAAGGTGATCCCC - 3' ve Sağ primer 5'- ATCAAGGCGATCTCTCCGG-3') hemT geni amplifiye etmek için tasarlanmış, hiçbir sonuç elde edilmemiştir. Primerlerin ilk seti R. Sphaeroides 2.4.1'in bir hemT geni kullanılarak dizayn edilmiştir ve ikinci seti R. Sphaeroides17029'in hemT geni kullanılarak dizayn edilmiştir. Sonuç, R. Sphaeroides O.U.001'in hemT geni değil, hemA genine sahip olduğunu göstermiştir. Projemizin, bu bağlamda, Rhodobacter Sphaeroides O.U.001'deki 5-aminolevulinate sentez genini araştıran ilk çalışma olduğu görülmüştür. Biz bu calışma ile 5-aminolevulinate synthase (hemA) geninin, hem aerobic, hem de anaerobic şartlarda ekspres edildiğini gösterdik.
Özet (Çeviri)
In purple non-sulfur bacteria Rhodobacter sphaeroides that are photosynthetic bacteria, 5-aminolevulinic acid (5-ALA) is formed by the condensation of glycine and succinyl-CoA, catalyzed by the pyridoxal-phosphate dependent enzyme ALA synthase in C4 pathway. The synthesis of 5-ALA occurs in different ways in living things: Succinyl-CoA and glycine (Shemin pathway, C-4 pathway) and using glutamate (C-5 pathway). The enzyme of the C-4 pathway is ALA synthase. There are two isoenzymes for ALA synthase and two genes (hemA and hemT) coding for these isoenzymes in R. sphaeroides. When the genes of the C-4 metabolic pathway are taken into account, there seem some variations. While there is only hemAgene in some strains, there are no genes at all in some other strains. This situation was stated as genomic complexity of R. sphaeroides. In order to solve this situation in R. sphaeroides O.U. 001, molecular cloning and sequence analysis of C4 pathway genes (hemA and hemT genes coding for the two ALA synthase isoenzymes) was performed. For this, different primer sets were designed to amplify the hemA and hemT genes by primer3 software. The first set of primers were designed using hemA genes of R. sphaeroides 2.4.1 using the primers (Left primer 5'-GCGATATAGGTGGCCTTGAT- 3' and Right primer 5'- CAGCCTATCGTCCGATGC - 3') , no product was obtained. The second set of hemA gene obtaind from R. sphaeroides 17025, hemA gene was amplified in Polymerase Chain Reaction (PCR) using the primers (Left primer 5'-CCTTTGCATCCGCAGAAGC- 3' and Right primer 5'- CCAATGAACGGGTTTCAAATTG -3'). The PCR was done using R. sphaeroides O.U. 001 gDNA as a template and PHUSION DNA polymerase enzyme. 1370 bp long hemA gene was successfully amplified. The sequence analysis was done using Next Generation Sequencing (NGS) and then homology/blast search was done at National Center for Biotechnology Information (NCBI). The hemA sequence of R. sphaeroides O.U.001 was found to be 99.6% similar to that of R. sphaeroides 17025. Then the hemA gene was cloned into the EcoRV site of pBluescript SK (+) cloning vector. After transformation into Escherichia coli XL1 Blue, the recombinant clones were selected by blue/white screening and confirmed by restriction enzyme digestion and sequence analysis. The glycerol stocks of recombinant clones were stored at -80ºC for future uses. Although two primer sets (First set of primers: Left primer 5'- CGCCGTACCTACACCCATAC - 3' and Right primer 5'- ATCCGGACGACCAAGCTG - 3', Second set of primer: Left primer 5'- TCCAACAGAAGGTGATCCCC - 3' and Right primer 5'- ATCAAGGCGATCTCTCCGG-3') were designed to amplify hemT gene, no product was obtained. The first set of primers were designed using hemT genes of R. sphaeroides 2.4.1 and the second set was designed using hemT genes of R. sphaeroides 17029. The result indicated that R. sphaeroides O.U.001 has hemA gene but not hemT gene. The hemA gene was found to be expressed in both aerobic and anaerobic conditions, but it was more pronounced in anaerobic conditions. There by, our project is the first record which focuses on the 5-aminolevulinate synthase gene in Rhodobacter Sphaeroides O.U.001. We demonstrated that 5-aminolevulinate synthase (hemA) gene presents in both conditions of aerobic and anaerobic.
Benzer Tezler
- Molecular cloning, sequencing and transcriptional analyses of c5 pathway genes of 5-aminolevulinic acid synthesis in rhodobacter sphaeroides o.u.001
Rhodobacter sphaeroides o.u.001'de c5 5-aminolevulinik asit sentez yolunda bulunan genlerin klonlanması, dizilenmesi ve transkripsiyonel analizleri
FARMESK IBRAHIM RIDHA RIDHA
Yüksek Lisans
İngilizce
2017
BiyoteknolojiSelçuk ÜniversitesiBiyoloji Ana Bilim Dalı
PROF. DR. GIYASETTİN KAŞIK
- Kırmızı floresan protein geninin klonlanması ve Cereibacter sphaeroides O.U.001'de ekspresyonu
Cloning of the red fluorescent protein gene and its expression in Cereibacter sphaeroides O.U.001
AYŞENUR ALTINKAYA
Yüksek Lisans
Türkçe
2025
GenetikNecmettin Erbakan ÜniversitesiMoleküler Biyoloji ve Genetik Ana Bilim Dalı
PROF. DR. GÖKHAN KARS
- Zeytin (Olea europaea) EST'leri (expressed sequence tags) koleksiyonundan seçilen lipid transfer geninin moleküler analizi
Molecular analysis of lipid transfer gene selected from olive (Olea europaea) ESTs (expressed sequence tags) collection
DİLEK ÇAĞLAR
Yüksek Lisans
Türkçe
2015
BiyolojiYıldız Teknik ÜniversitesiMoleküler Biyoloji ve Genetik Ana Bilim Dalı
DOÇ. DR. NEHİR ÖZDEMİR ÖZGENTÜRK
- Türkiye turunçgil alanlarındaki tristeza virüs izolatlarının kılıf protein genlerinin klonlaması, dna diziliminin belirlenmesi ve analizi
Molecular cloning, sequencing and analysis of the coat protein genes of citrus tristeza virus isolates from different citrus growing regions of Turkey
GÖZDE ERKIŞ
Yüksek Lisans
Türkçe
2009
ZiraatSüleyman Demirel ÜniversitesiBitki Koruma Ana Bilim Dalı
DOÇ. DR. BAYRAM ÇEVİK
- Yüksek tuz toleransına sahip fasulye genotipinde tolerans ile ilgili transkripsiyon faktörlerinin belirlenmesi
Determi̇nati̇on of transcri̇pti̇on factors related to tolerances i̇n bean genotype wi̇th hi̇gh salt tolerances
GÖKHAN GÖKDEMİR
Yüksek Lisans
Türkçe
2017
BiyoteknolojiOndokuz Mayıs ÜniversitesiTarımsal Biyoteknoloji Ana Bilim Dalı
DOÇ. DR. MUSA KAVAS