Geri Dön

Molecular cloning, sequencing and transcriptional analyses of c5 pathway genes of 5-aminolevulinic acid synthesis in rhodobacter sphaeroides o.u.001

Rhodobacter sphaeroides o.u.001'de c5 5-aminolevulinik asit sentez yolunda bulunan genlerin klonlanması, dizilenmesi ve transkripsiyonel analizleri

  1. Tez No: 453528
  2. Yazar: FARMESK IBRAHIM RIDHA RIDHA
  3. Danışmanlar: PROF. DR. GIYASETTİN KAŞIK
  4. Tez Türü: Yüksek Lisans
  5. Konular: Biyoloji, Biyoteknoloji, Biology, Biotechnology
  6. Anahtar Kelimeler: Belirtilmemiş.
  7. Yıl: 2017
  8. Dil: İngilizce
  9. Üniversite: Selçuk Üniversitesi
  10. Enstitü: Fen Bilimleri Enstitüsü
  11. Ana Bilim Dalı: Biyoloji Ana Bilim Dalı
  12. Bilim Dalı: Moleküler Biyoloji Bilim Dalı
  13. Sayfa Sayısı: 56

Özet

5-aminolevulinik asit (5-ALA), porfirin, vitamin B12 ve klorofil sentezinde bir öncü madde olarak kullanılır. 5-ALA, tarım, ilaç ve biyo-teknolojinin birçok alanında kullanılan yüksek katma değerli bir maddedir. 5-ALA'nın kimyasal sentezi birçok kompleks basamağın varlığı nedeniyle oldukça pahalıdır, ancak Rhodobacter sphaeroides gibi bazı fotosentetik bakteriler daha düşük maliyetle 5-ALA sentezleyebilirler. 5-ALA sentezi canlılarda iki farklı yoldan meydana gelir: (1) Succinyl-CoA ve glisin (Shemin yolu, C-4 yolu) ve (2) glutamat (C-5 yolu). R. sphaeroides C-4 yolu ile 5-ALA sentezlemesine rağmen, C-5 yolunun birinci ve üçüncü enzimleri ve genlerine sahiptir. C-4 ve C-5 metabolik yollarının genleri ve enzimleri dikkate alındığında, birçok farklılık veya varyasyon ortaya çıkar. Bu durum, R. sphaeroides'in genomik karmaşıklığı olarak belirtilmiştir. Benzer şekilde, C-5 5-ALA sentez yolunda glutamil tRNA sintaz, glutamil tRNA redüktaz ve GSA aminotransferaz genlerinde de farklılıklar olduğu öngörülmektedir. Bu durumu kısmen R. sphaeroides'de çözmek için, Rhodobacter sphaeroides O.U.001'deki glutamat-1 semialdehit aminotransferaz (GSA aminotransferaz) ve glutamil tRNA sintaz genlerinin moleküler klonlama, sıralama analizi ve transkripsiyonel analizleri gerçekleştirildi. Bu şekilde, C-5 5-ALA sentez yolunda bulunan genlerin zinciri tespit edildi. Bunun için, yukarı akış ve aşağı akış sekanslarının çevrelediği GSA aminotransferaz ve glutamil tRNA sentaz genleri, polimeraz zincir reaksiyonunda (PCR) primer çiftleri kullanılarak güçlendirildi. (Sol: 5'-GATCGAGATCGGCAGGTG-3 ve Sağ; 5 '-ACTATGTGGCGTGATGG-3) ikinci gen kullanılmıştır (Sol; 5`CGTCGATGTAGGTGATGGTG`3 ve Sağ; 5`ATCCCGATTCCGAGAAACAC`3). Primerler, R.sphaeroides 17025'in GSA aminotransferaz ve glutamil tRNA sintaz gen dizisi kullanılarak Primer3 yazılımı kullanılarak tasarlandı. PCR, R. sphaeroides O.U. 001 gDNA şablonu ve PHUSION DNA polimeraz enzimi kullanılarak yapıldı. PCR gerçekleştirildiğinde, 1912 bp PCR ürünü başarıyla elde edildi. PCR ürünü dizilime gönderildi ve GSA aminotransferaz ve glutamil tRNA sintaz genlerinin tüm dizisini elde etmek için Yeni Nesil Sıralama (NGS) uygulandı. Ulusal Biyoteknoloji Enformasyon Merkezi (NCBI) homoloji / patlama araştırmasından sonra, elde edilen R. sphaeroides O.U.001'in GSA aminotransferaz geninin sırası, GSA aminotransferaz'ınkine % 99.8 benzer bulundu. R. sphaeroides geni R.saferoides O.U.001'in 17025 GTS geninin homoloji / patlama araştırmasından sonra benzer şekilde % 99.1 olduğu bulundu. Onay üzerine, pBluescript SK (+) klonlama vektörü EcoRV ile kesildi ve GSA aminotransferazglutamil tRNA sentaz genleri bu bölgeye klonlandı. Escherichia coli XL1 Mavi'ye dönüştürüldükten sonra, rekombinant klonlar mavi / beyaz tarama ile seçildi ve kısıtlama enzimi sindirimi ve dizi (sekans) analizi ile teyit edildi. Rekombinant klonların gliserol stoğu, gelecek kullanımlar için -80ºC'de saklandı. Fotosentetik genler anaerobik ve aerobik koşullar altında ifade edilir. Benzer şekilde, glutamil-tRNA sentaz ve glutamat-1-semialdehit aminotransferaz genleri esas olarak anaerobik koşullar altında sunulur.

Özet (Çeviri)

5-aminolevulinic acid (5-ALA) is used as a precursor substance in the synthesis of porphyrin, vitamin B12 and chlorophyll. 5-ALA is a high value added substance used in many areas in agriculture, medicine, and biotechnology. The chemical synthesis of 5-ALA is quite expensive due to the presence of many complex steps but some photosynthetic bacteria like Rhodobacter sphaeroides can synthesize 5-ALA at lower cost. The synthesis of 5-ALA occurs in two different ways in living things: (1) Succinyl-CoA and glycine (Shemin pathway, C-4 pathway) and (2) using glutamate (C-5 pathway). Although R. sphaeroides synthesize 5-ALA through C-4 pathway, it has the first and the third enzymes and genes of the C-5 pathway. When the genes and enzymes of the C-4 and C-5 metabolic pathways are taken into account, there occur many variations or differences. This situation was stated as genomic complexity of R. sphaeroides. Similarly, it is foreseen that there are also differences in terms of glutamyl tRNA synthase, glutamyl tRNA reductase and GSA aminotransferase genes in C-5 5-ALA synthesis pathway. In order to solve this situation partly in R. sphaeroides, molecular cloning, sequencing and transcriptional analysis of glutamate-1 semialdehyde aminotransferase (GSA aminotransferase) and glutamyl tRNA synthase genes in Rhodobacter sphaeroides O.U.001 was performed. In this way, two of the genes present in the C-5 5-ALA synthesis pathway was identified. For this, GSA aminotransferase and glutamyl tRNA synthase genes flanked by upstream and downstream sequences was amplified in Polymerase Chain Reaction (PCR) using the primer pairs (Left: 5`-GATCGAGATCGGCAGGTG-`3 and Right; 5`- GACTATGTGGGCGTGATGG-`3) the second gene has been used (Left;5`CGTCGATGTAGGTGATGGTG`3 and Right;5`ATCCCGATTCCGAGAAACAC`3). The primers were designed using Primer3 software using the GSA aminotransferase and glutamyl tRNA synthase genes sequence of R. sphaeroides 17025. The PCR was done using R. sphaeroides O.U. 001 gDNA as a template and PHUSION DNA polymerase enzyme. Up on performing PCR, 1912 bp 1940bp PCR product was successfully obtained. The PCR product was sent to sequencing, and Next Generation Sequencing (NGS) was applied to obtain whole sequence of GSA aminotransferase and glutamyl tRNA synthase genes. After homology/blast search at National Center for Biotechnology Information (NCBI), the obtained sequence of GSA aminotransferase gene of R. sphaeroides O.U.001 was found to be 99.8% similar to that of GSA aminotransferase gene of R. sphaeroides 17025 GTS gene of R. sphaeroides O.U.001 was found to be 99.1% also similar after homology/blast search. Upon confirmation, pBluescript SK (+) cloning vector was cut with EcoRV and the GSA aminotransferase, glutamyl tRNA synthase genes were cloned to this site. After transformation into Escherichia coli XL1 Blue, the recombinant clones were selected by blue/white screening and confirmed by restriction enzyme digestion and sequence analysis. The glycerol stocks of recombinant clones were stored at -80ºC for future uses. Photosynthetic genes are expressed under aerobic and anaerobic condition. Similarly, glutamyl-tRNA synthase and glutamate-1-semialdehyde aminotransferase genes were mainly expressed under anaerobic conditions.

Benzer Tezler

  1. Molecular cloning, sequencing and transcriptional analyses of the genes coding for 5-aminolevulinic acid synthase isoenzymes in Rhodobacter sphaeroides O.U.001

    Rhodobacter sphaeroıdes O.U.001'de bulunan 5-aminolevulinik asit sentaz izoenzimlerini kodlayan genlerin klonlanması, dizilenmesi ve transkipsiyonel analizleri

    MARWA HASSAN JAWAD JAWAD

    Yüksek Lisans

    İngilizce

    İngilizce

    2017

    BiyolojiSelçuk Üniversitesi

    Biyoloji Ana Bilim Dalı

    PROF. DR. GIYASETTİN KAŞIK

  2. Kırmızı floresan protein geninin klonlanması ve Cereibacter sphaeroides O.U.001'de ekspresyonu

    Cloning of the red fluorescent protein gene and its expression in Cereibacter sphaeroides O.U.001

    AYŞENUR ALTINKAYA

    Yüksek Lisans

    Türkçe

    Türkçe

    2025

    GenetikNecmettin Erbakan Üniversitesi

    Moleküler Biyoloji ve Genetik Ana Bilim Dalı

    PROF. DR. GÖKHAN KARS

  3. Türkiye turunçgil alanlarındaki tristeza virüs izolatlarının kılıf protein genlerinin klonlaması, dna diziliminin belirlenmesi ve analizi

    Molecular cloning, sequencing and analysis of the coat protein genes of citrus tristeza virus isolates from different citrus growing regions of Turkey

    GÖZDE ERKIŞ

    Yüksek Lisans

    Türkçe

    Türkçe

    2009

    ZiraatSüleyman Demirel Üniversitesi

    Bitki Koruma Ana Bilim Dalı

    DOÇ. DR. BAYRAM ÇEVİK

  4. TTH polimeraz enziminin tıbbi moleküler tanı kitlerinde kullanım amaçlı rekombinant üretimi

    Expression of recombinant TTH polymerase enzyme for development of medical molecular diagnostic kits

    HÜMEYRA AYDIN

    Yüksek Lisans

    Türkçe

    Türkçe

    2017

    BiyomühendislikGaziosmanpaşa Üniversitesi

    Biyomühendislik Ana Bilim Dalı

    PROF. DR. İSA GÖKÇE

  5. Zeytin (Olea europaea) EST'leri (expressed sequence tags) koleksiyonundan seçilen lipid transfer geninin moleküler analizi

    Molecular analysis of lipid transfer gene selected from olive (Olea europaea) ESTs (expressed sequence tags) collection

    DİLEK ÇAĞLAR

    Yüksek Lisans

    Türkçe

    Türkçe

    2015

    BiyolojiYıldız Teknik Üniversitesi

    Moleküler Biyoloji ve Genetik Ana Bilim Dalı

    DOÇ. DR. NEHİR ÖZDEMİR ÖZGENTÜRK